// createfiles.cpp
// Assignment#1: sample file creator

#include <iostream>
#include <fstream>
#include <string>
using namespace std;

/****** To generate other files of your choice, follow comments *******/

int main() { 

  long lc1[200],lc2[200]; // better use long (4 bytes) for indices/byte-offset
  char a[200];

  strcpy(a,"ACATATATATATCTACGGTACGTGTCGTGT"); // change to string of your choice
  lc1[0]=3; lc2[0]=11; // change for indices (beg, end) of your choice
  lc1[1]=20; lc2[1]=29;
  int numlc=2; // write here how many indices were in previous lines

  fstream genome, lowcomp;

  genome.open("genome1.txt",ios::out|ios::trunc); // change output file name

  for (int j=0;a[j]!='\0'; j++)
     genome.put(a[j]);

  lowcomp.open("lowcomp1.txt",ios::out|ios::trunc); // change output file name

  for (int i=0; i<numlc; i++)
    lowcomp<<lc1[i]<<" "<<lc2[i]<<"\n";

  genome.close();
  lowcomp.close();
  cout<<"End of program. Check files genome1.txt and lowcomp1.txt.\n"; 
                                     // change file names
}